Transcript: Mouse NM_178705.5

Mus musculus leucine zipper protein 2 (Luzp2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Luzp2 (233271)
Length:
5274
CDS:
715..1752

Additional Resources:

NCBI RefSeq record:
NM_178705.5
NBCI Gene record:
Luzp2 (233271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178705.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217401 GAGCTAGACTGTGGCATAATT pLKO.1 2653 3UTR 100% 15.000 21.000 N Luzp2 n/a
2 TRCN0000192816 GCAATGAAAGAGACCGTACAA pLKO.1 1327 CDS 100% 4.950 6.930 N Luzp2 n/a
3 TRCN0000191891 GATTTGTTATTTAAGGCCCAA pLKO.1 1222 CDS 100% 2.160 3.024 N Luzp2 n/a
4 TRCN0000189834 GCTCCGTTATGGGAAGAAAGA pLKO.1 1203 CDS 100% 4.950 3.960 N Luzp2 n/a
5 TRCN0000216133 CACAACACAGAAATTACAAAT pLKO.1 1638 CDS 100% 13.200 9.240 N Luzp2 n/a
6 TRCN0000202455 GTCCTCAAGATGAGGGTAGTT pLKO.1 1559 CDS 100% 4.950 3.465 N Luzp2 n/a
7 TRCN0000189735 GCCATCAAATCCAACCCAGAT pLKO.1 1398 CDS 100% 4.050 2.835 N Luzp2 n/a
8 TRCN0000143120 CAGGACTATGAAGAGCTAGAA pLKO.1 778 CDS 100% 4.950 3.465 N LUZP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178705.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.