Transcript: Mouse NM_178740.4

Mus musculus SLIT and NTRK-like family, member 4 (Slitrk4), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Slitrk4 (245446)
Length:
3935
CDS:
320..2833

Additional Resources:

NCBI RefSeq record:
NM_178740.4
NBCI Gene record:
Slitrk4 (245446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178740.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412381 GAAACCACCTTGGTCTAATTT pLKO_005 481 CDS 100% 15.000 21.000 N SLITRK4 n/a
2 TRCN0000078623 CGTCTCTTTGTGCTTTGTAAA pLKO.1 3147 3UTR 100% 13.200 9.240 N SLITRK4 n/a
3 TRCN0000078795 GCCCTGATTTCTTCTACAAAT pLKO.1 350 CDS 100% 13.200 9.240 N Slitrk4 n/a
4 TRCN0000078796 CCATTTGGATATACGAGGAAA pLKO.1 862 CDS 100% 4.950 3.465 N Slitrk4 n/a
5 TRCN0000078793 GCATCTTGAAATTGCTGGATT pLKO.1 3384 3UTR 100% 4.950 3.465 N Slitrk4 n/a
6 TRCN0000078797 GCTGACACTTTCCTTGGCATA pLKO.1 689 CDS 100% 4.050 2.835 N Slitrk4 n/a
7 TRCN0000078794 GCCAAGAAGTTGCATGTCAAT pLKO.1 1454 CDS 100% 4.950 2.970 N Slitrk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178740.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09576 pDONR223 100% 90.8% 97.2% None (many diffs) n/a
2 ccsbBroad304_09576 pLX_304 0% 90.8% 97.2% V5 (many diffs) n/a
3 TRCN0000479202 GGACGCAGTTTAATACCGAACCGT pLX_317 15% 90.8% 97.2% V5 (many diffs) n/a
Download CSV