Transcript: Mouse NM_178756.4

Mus musculus phospholipid phosphatase related 1 (Plppr1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Plppr1 (272031)
Length:
3762
CDS:
202..1179

Additional Resources:

NCBI RefSeq record:
NM_178756.4
NBCI Gene record:
Plppr1 (272031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429218 TTTGTCTAGTTAGAGGCTAAT pLKO_005 1308 3UTR 100% 10.800 15.120 N Plppr1 n/a
2 TRCN0000050423 CGCCTTATATGCCACGATGTA pLKO.1 822 CDS 100% 4.950 6.930 N PLPPR1 n/a
3 TRCN0000050426 CTGAGCATTTACTCCGCCTTA pLKO.1 808 CDS 100% 4.050 5.670 N PLPPR1 n/a
4 TRCN0000081319 CCACTCCAACTGCTATTATTT pLKO.1 437 CDS 100% 15.000 10.500 N Plppr1 n/a
5 TRCN0000415307 AGTCGTCACTGGTCACCTAAC pLKO_005 639 CDS 100% 6.000 4.200 N Plppr1 n/a
6 TRCN0000444504 GCTTGCCTACTACTTCGAATG pLKO_005 291 CDS 100% 6.000 4.200 N Plppr1 n/a
7 TRCN0000081318 CCCAGGAAAGAATGATTTGTA pLKO.1 2974 3UTR 100% 5.625 3.938 N Plppr1 n/a
8 TRCN0000081321 CATTGGTGAAATATCCATGTA pLKO.1 459 CDS 100% 4.950 3.465 N Plppr1 n/a
9 TRCN0000081320 CCGAAGGATCATCAGGTTCAT pLKO.1 564 CDS 100% 4.950 3.465 N Plppr1 n/a
10 TRCN0000050425 CGGAGACTTAATGAAGCCTTA pLKO.1 357 CDS 100% 4.050 2.835 N PLPPR1 n/a
11 TRCN0000081322 CCAAGGATTCTTCTGTCAGGA pLKO.1 336 CDS 100% 2.640 1.848 N Plppr1 n/a
12 TRCN0000359525 CCTTATATGCCACGATGTATA pLKO_005 824 CDS 100% 13.200 10.560 N PLPPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03474 pDONR223 100% 90.6% 96.3% None (many diffs) n/a
2 ccsbBroad304_03474 pLX_304 0% 90.6% 96.3% V5 (many diffs) n/a
3 TRCN0000469847 GAGTAGGCTCCAAAGGCCGCCGCT pLX_317 36.3% 90.6% 96.3% V5 (many diffs) n/a
Download CSV