Transcript: Mouse NM_178793.4

Mus musculus collagen and calcium binding EGF domains 1 (Ccbe1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccbe1 (320924)
Length:
5742
CDS:
85..1311

Additional Resources:

NCBI RefSeq record:
NM_178793.4
NBCI Gene record:
Ccbe1 (320924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178793.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091779 GAGACCGTACTGTCTGGATAT pLKO.1 471 CDS 100% 10.800 15.120 N Ccbe1 n/a
2 TRCN0000091781 CAAGTATGTCAATGGTGACAA pLKO.1 780 CDS 100% 0.495 0.396 N Ccbe1 n/a
3 TRCN0000091782 CAGTGTATTCCAGAAGATTAT pLKO.1 337 CDS 100% 13.200 9.240 N Ccbe1 n/a
4 TRCN0000091778 CCCAGTTAGAAAGGCAGGATT pLKO.1 3356 3UTR 100% 4.950 3.465 N Ccbe1 n/a
5 TRCN0000091780 CCCTGACCTGTCTCATATTAA pLKO.1 963 CDS 100% 15.000 9.000 N Ccbe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178793.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13238 pDONR223 100% 46% 47.3% None (many diffs) n/a
2 ccsbBroad304_13238 pLX_304 0% 46% 47.3% V5 (many diffs) n/a
3 TRCN0000468830 GTGTAAAAGATTTGCGCTGATTGG pLX_317 60.9% 46% 47.3% V5 (many diffs) n/a
Download CSV