Transcript: Human NM_178815.5

Homo sapiens ADP ribosylation factor like GTPase 5B (ARL5B), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARL5B (221079)
Length:
7170
CDS:
208..747

Additional Resources:

NCBI RefSeq record:
NM_178815.5
NBCI Gene record:
ARL5B (221079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178815.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382340 ACAGGGAACGACTAGCTATTA pLKO_005 491 CDS 100% 13.200 18.480 N ARL5B n/a
2 TRCN0000047936 GTAACCAAGAACACAAAGTAA pLKO.1 245 CDS 100% 5.625 7.875 N ARL5B n/a
3 TRCN0000047933 CCTCACCCTTAGTTCAATTAA pLKO.1 630 CDS 100% 15.000 12.000 N ARL5B n/a
4 TRCN0000425196 AGTTGTGAAGAACACTCATTT pLKO_005 372 CDS 100% 13.200 9.240 N ARL5B n/a
5 TRCN0000379548 ATGTTGGCTCATGAGGATTTA pLKO_005 532 CDS 100% 13.200 9.240 N ARL5B n/a
6 TRCN0000382312 TTATAGTGGGACTGGATAATG pLKO_005 266 CDS 100% 13.200 9.240 N ARL5B n/a
7 TRCN0000047937 CCAACCATAGGAAGCAATGTT pLKO.1 343 CDS 100% 5.625 3.938 N ARL5B n/a
8 TRCN0000047934 GCGATCATCCTGGAACACATA pLKO.1 426 CDS 100% 4.950 3.465 N ARL5B n/a
9 TRCN0000419664 TCTTAATGAATGAAGTGGTTC pLKO_005 314 CDS 100% 4.050 2.835 N ARL5B n/a
10 TRCN0000047935 GCAGTCCTTATCTTTGCAAAT pLKO.1 562 CDS 100% 10.800 6.480 N ARL5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178815.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.