Transcript: Human NM_178822.4

Homo sapiens immunoglobulin superfamily member 10 (IGSF10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
IGSF10 (285313)
Length:
8571
CDS:
1..7872

Additional Resources:

NCBI RefSeq record:
NM_178822.4
NBCI Gene record:
IGSF10 (285313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178822.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144401 CAGGCGTATATCACTGTATAA pLKO.1 1637 CDS 100% 13.200 10.560 N IGSF10 n/a
2 TRCN0000141835 GCATCAGTGGAGAATCTCTAT pLKO.1 7331 CDS 100% 4.950 3.960 N IGSF10 n/a
3 TRCN0000418957 AGGAATAAAGTTGGCTATATT pLKO_005 7240 CDS 100% 15.000 10.500 N IGSF10 n/a
4 TRCN0000141156 CCAATGTGGAACGCATCAATT pLKO.1 170 CDS 100% 13.200 9.240 N IGSF10 n/a
5 TRCN0000139748 CCCAATGTGGAACGCATCAAT pLKO.1 169 CDS 100% 5.625 3.938 N IGSF10 n/a
6 TRCN0000144096 CCACAAATAGTCATCAGACAT pLKO.1 2849 CDS 100% 4.950 3.465 N IGSF10 n/a
7 TRCN0000140565 GCTTTCAGATTCAGCCGACTT pLKO.1 6912 CDS 100% 4.050 2.835 N IGSF10 n/a
8 TRCN0000141499 CCACCTGTTATTCTAGAGCAA pLKO.1 5521 CDS 100% 2.640 1.848 N IGSF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178822.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09976 pDONR223 100% 22.9% 22.9% None (many diffs) n/a
2 ccsbBroad304_09976 pLX_304 0% 22.9% 22.9% V5 (many diffs) n/a
3 TRCN0000474048 CAATTTGGGCATCGCGCACCGAAA pLX_317 20.3% 22.9% 22.9% V5 (many diffs) n/a
Download CSV