Transcript: Mouse NM_178892.5

Mus musculus TCDD-inducible poly(ADP-ribose) polymerase (Tiparp), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tiparp (99929)
Length:
4154
CDS:
228..2201

Additional Resources:

NCBI RefSeq record:
NM_178892.5
NBCI Gene record:
Tiparp (99929)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178892.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219477 TGATGTGGAACAACCATTATA pLKO.1 1375 CDS 100% 15.000 21.000 N Tiparp n/a
2 TRCN0000241932 CACCGTATTGCCCTATCATTG pLKO_005 1013 CDS 100% 10.800 15.120 N Tiparp n/a
3 TRCN0000219479 TGACCAGAGTTACCCTTATTT pLKO.1 2138 CDS 100% 15.000 12.000 N Tiparp n/a
4 TRCN0000219480 ATACGTTCATGTAAGTCTAAT pLKO.1 2698 3UTR 100% 13.200 10.560 N Tiparp n/a
5 TRCN0000219476 AGATCCTTGAGGCCAATATTA pLKO.1 390 CDS 100% 15.000 10.500 N Tiparp n/a
6 TRCN0000219478 GTTTGGACAAGGCAGTTATTT pLKO.1 1901 CDS 100% 15.000 10.500 N Tiparp n/a
7 TRCN0000273168 GTTTGGACAAGGCAGTTATTT pLKO_005 1901 CDS 100% 15.000 10.500 N TIPARP n/a
8 TRCN0000241934 ACTGATACTATCGTGCTTATT pLKO_005 2639 3UTR 100% 13.200 9.240 N Tiparp n/a
9 TRCN0000241933 AGTCCTGACTGCGTAGATAAA pLKO_005 750 CDS 100% 13.200 9.240 N Tiparp n/a
10 TRCN0000004462 GAAGGCAAGCTACTCTCATAA pLKO.1 1928 CDS 100% 13.200 9.240 N TIPARP n/a
11 TRCN0000273169 GAAGGCAAGCTACTCTCATAA pLKO_005 1928 CDS 100% 13.200 9.240 N TIPARP n/a
12 TRCN0000257090 TACACCACCCTGTAGTAATTC pLKO_005 1226 CDS 100% 13.200 9.240 N Tiparp n/a
13 TRCN0000257044 TGAGTCTGTTGTTCGACTAAT pLKO_005 1313 CDS 100% 13.200 9.240 N Tiparp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178892.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.