Transcript: Mouse NM_178918.3

Mus musculus UTP15 small subunit processome component (Utp15), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Utp15 (105372)
Length:
4071
CDS:
201..1787

Additional Resources:

NCBI RefSeq record:
NM_178918.3
NBCI Gene record:
Utp15 (105372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126747 GCTGATGACTATACTGTTAAA pLKO.1 621 CDS 100% 13.200 18.480 N Utp15 n/a
2 TRCN0000126746 GCTCGGACAAATAAGAATGTT pLKO.1 780 CDS 100% 5.625 7.875 N Utp15 n/a
3 TRCN0000126745 GCCTGCATATCGAACCTTTAT pLKO.1 1196 CDS 100% 13.200 9.240 N Utp15 n/a
4 TRCN0000126744 CGCAGGAATTAAAGGTGTGTT pLKO.1 3005 3UTR 100% 4.950 3.465 N Utp15 n/a
5 TRCN0000126748 GCAGTGTCCAAAGTAGACTTT pLKO.1 318 CDS 100% 4.950 3.465 N Utp15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12781 pDONR223 100% 44.8% 46.3% None (many diffs) n/a
2 ccsbBroad304_12781 pLX_304 0% 44.8% 46.3% V5 (many diffs) n/a
3 TRCN0000491306 ACGATACGAACAACTTCACTAGGC pLX_317 31.5% 44.8% 46.3% V5 (many diffs) n/a
Download CSV