Construct: ORF TRCN0000491306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004608.2_s317c1
- Derived from:
- ccsbBroadEn_12781
- DNA Barcode:
- ACGATACGAACAACTTCACTAGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UTP15 (84135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84135 | UTP15 | UTP15 small subunit process... | NM_001284431.1 | 86.7% | 86.8% | 1_129del;642A>C |
2 | human | 84135 | UTP15 | UTP15 small subunit process... | NM_001284430.1 | 57% | 57.1% | 1_642del;1155A>C |
3 | human | 84135 | UTP15 | UTP15 small subunit process... | NM_032175.4 | 54.9% | 55% | 1_699del;1212A>C |
4 | human | 84135 | UTP15 | UTP15 small subunit process... | XM_011543680.2 | 54.9% | 55% | 1_699del;1212A>C |
5 | mouse | 105372 | Utp15 | UTP15 small subunit process... | NM_178918.3 | 44.8% | 46.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt aaaaggagga caattgctag tatctttgaa aaatcatcac aaaaccgtga 121 catgtttatg tctaagcagc tctggacaga ggttactctc tggctcactg gataggaagg 181 tgaaagtata cagcacaact tcctacaaag tagtccacag ttttgattat gcagcttcaa 241 ttttgagtct tgcccttgca catgaagatg agacaatagt tgtaggaatg accaatggaa 301 tactgagtgt taaacatcgg aaatctgaag caaagaagga atcacttccc agaagaagaa 361 ggcctgcata tcgaaccttt attaaaggaa aaaattacat gaagcaacgg gatgacattt 421 tgattaacag gccagcaaag aagcacctag aattgtatga cagggatctg aaacattttc 481 ggatctctaa ggcactcgat agagttcttg atcccacttg tacaataaag acacccgaga 541 ttacggtgtc catcataaag gagttaaatc gaagaggcgt ccttgcaaat gcgcttgcag 601 gtcgggatga gaaggaaatc agtcatgttc ttaatttttt gataaggaat ctttcTCAGC 661 CAAGATTTGC CCCTGTTTTA ATCAATGCTG CTGAAATAAT TATTGATATA TATCTGCCTG 721 TAATTGGTCA GTCCCCTGTA GTTGATAAAA AGTTTTTACT ACTTCAAGGA CTTGTAGAAA 781 AAGAGATTGA TTACCAAAGA GAATTGTTAG AAACCTTGGG GATGATGGAT ATGCTTTTTG 841 CCACCATGAG AAGGAAGGAA GGCACTTCTG TGTTGGAACA CACATCTGAT GGATTTCCAG 901 AGAATAAGAA GATAGAATCA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACGA TACGAACAAC 1081 TTCACTAGGC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt