Transcript: Human NM_180977.3

Homo sapiens protein phosphatase 2 regulatory subunit B'delta (PPP2R5D), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PPP2R5D (5528)
Length:
2655
CDS:
109..1599

Additional Resources:

NCBI RefSeq record:
NM_180977.3
NBCI Gene record:
PPP2R5D (5528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_180977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080667 CATCGCATCTATGGCAAGTTT pLKO.1 577 CDS 100% 5.625 7.875 N Ppp2r5d n/a
2 TRCN0000080666 GCATCGCATCTATGGCAAGTT pLKO.1 576 CDS 100% 4.950 6.930 N Ppp2r5d n/a
3 TRCN0000325682 GCATCGCATCTATGGCAAGTT pLKO_005 576 CDS 100% 4.950 6.930 N Ppp2r5d n/a
4 TRCN0000367676 AGTCTGACTGAGCCGGTAATT pLKO_005 856 CDS 100% 13.200 10.560 N PPP2R5D n/a
5 TRCN0000356029 CAATCCATGGACTGATCTATA pLKO_005 1172 CDS 100% 13.200 10.560 N PPP2R5D n/a
6 TRCN0000355971 CTTGCTCTCCTAGACCTATTT pLKO_005 511 CDS 100% 13.200 9.240 N PPP2R5D n/a
7 TRCN0000002555 GTGGACAATAACTGATGAATA pLKO.1 2196 3UTR 100% 13.200 9.240 N PPP2R5D n/a
8 TRCN0000356028 CACATCTCCAGCTCGTGTATG pLKO_005 413 CDS 100% 10.800 7.560 N PPP2R5D n/a
9 TRCN0000002554 CCACATCTTCTACAGGTTCAT pLKO.1 633 CDS 100% 4.950 3.465 N PPP2R5D n/a
10 TRCN0000010715 CCAGCCAAACATAGCCAAGAA pLKO.1 468 CDS 100% 4.950 3.465 N PPP2R5D n/a
11 TRCN0000002553 TGCACTCTACAGGAACTCCAA pLKO.1 1134 CDS 100% 2.640 1.848 N PPP2R5D n/a
12 TRCN0000002552 GAGTTCTTCTTACGTTTCCTT pLKO.1 433 CDS 100% 3.000 1.800 N PPP2R5D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_180977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13926 pDONR223 100% 81.4% 1.1% None (many diffs) n/a
2 ccsbBroad304_13926 pLX_304 0% 81.4% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469042 ACACTTGCTCAATAGCTTAGAATA pLX_317 23.6% 81.4% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV