Transcript: Mouse NM_181072.3

Mus musculus myosin IE (Myo1e), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Myo1e (71602)
Length:
4944
CDS:
352..3675

Additional Resources:

NCBI RefSeq record:
NM_181072.3
NBCI Gene record:
Myo1e (71602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100547 CGCCAACGATATTATTGATAT pLKO.1 3567 CDS 100% 13.200 18.480 N Myo1e n/a
2 TRCN0000287932 CGCCAACGATATTATTGATAT pLKO_005 3567 CDS 100% 13.200 18.480 N Myo1e n/a
3 TRCN0000100546 CCCGCAAGAAATATGTTCAAA pLKO.1 2483 CDS 100% 5.625 7.875 N Myo1e n/a
4 TRCN0000298398 CCCGCAAGAAATATGTTCAAA pLKO_005 2483 CDS 100% 5.625 7.875 N Myo1e n/a
5 TRCN0000100548 CGAGCAAGAATATGACAGTTT pLKO.1 2862 CDS 100% 4.950 6.930 N Myo1e n/a
6 TRCN0000287933 CGAGCAAGAATATGACAGTTT pLKO_005 2862 CDS 100% 4.950 6.930 N Myo1e n/a
7 TRCN0000100549 CGCCATGAATGTGATTGGAAT pLKO.1 1131 CDS 100% 4.950 6.930 N Myo1e n/a
8 TRCN0000100545 CCTCCCTTACTTCCTAAATAA pLKO.1 4603 3UTR 100% 15.000 10.500 N Myo1e n/a
9 TRCN0000288008 CCTCCCTTACTTCCTAAATAA pLKO_005 4603 3UTR 100% 15.000 10.500 N Myo1e n/a
10 TRCN0000295426 TGCGTATCTGCTGGGTATAAA pLKO_005 1275 CDS 100% 15.000 10.500 N Myo1e n/a
11 TRCN0000152421 CAGAAGCAACTACCTCTGAAA pLKO.1 2947 CDS 100% 4.950 3.465 N MYO1E n/a
12 TRCN0000338525 CAGAAGCAACTACCTCTGAAA pLKO_005 2947 CDS 100% 4.950 3.465 N MYO1E n/a
13 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4885 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14706 pDONR223 89% 88.5% 19.3% None (many diffs) n/a
Download CSV