Transcript: Mouse NM_181315.4

Mus musculus carbonic anhydrase 5b, mitochondrial (Car5b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Car5b (56078)
Length:
3465
CDS:
127..1080

Additional Resources:

NCBI RefSeq record:
NM_181315.4
NBCI Gene record:
Car5b (56078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114427 GCCATGACTATGTGCTCAATA pLKO.1 1016 CDS 100% 13.200 18.480 N Car5b n/a
2 TRCN0000114429 CGCAGTCAAATTTGAAAGTTT pLKO.1 606 CDS 100% 5.625 4.500 N Car5b n/a
3 TRCN0000114428 CCATGACTATGTGCTCAATAT pLKO.1 1017 CDS 100% 13.200 9.240 N Car5b n/a
4 TRCN0000114430 CTGGTGGAATTTGGATCATTT pLKO.1 751 CDS 100% 13.200 9.240 N Car5b n/a
5 TRCN0000114426 GCAGTCTCTATACCTGCACAT pLKO.1 227 CDS 100% 4.050 2.835 N Car5b n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1829 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02656 pDONR223 100% 87.7% 89.2% None (many diffs) n/a
2 ccsbBroad304_02656 pLX_304 0% 87.7% 89.2% V5 (many diffs) n/a
3 TRCN0000473231 TTTATTATGATGATGGTGAGCTTC pLX_317 46% 87.7% 89.2% V5 (many diffs) n/a
Download CSV