Transcript: Mouse NM_181415.4

Mus musculus attractin like 1 (Atrnl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Atrnl1 (226255)
Length:
6596
CDS:
321..4457

Additional Resources:

NCBI RefSeq record:
NM_181415.4
NBCI Gene record:
Atrnl1 (226255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110936 CCGATGAATTATGGGTGTTTA pLKO.1 1462 CDS 100% 13.200 18.480 N Atrnl1 n/a
2 TRCN0000110935 GCATGATAGTTCTACTCTATT pLKO.1 6048 3UTR 100% 13.200 18.480 N Atrnl1 n/a
3 TRCN0000110938 CCTCTATAAGTACGAAGTCAA pLKO.1 1817 CDS 100% 4.950 3.960 N Atrnl1 n/a
4 TRCN0000110939 GCCTTCTGATAATAAAGACAA pLKO.1 4379 CDS 100% 4.950 3.960 N Atrnl1 n/a
5 TRCN0000110937 GCTATGATAATGCCAAACTTT pLKO.1 2620 CDS 100% 5.625 3.938 N Atrnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15032 pDONR223 96.6% 29.8% 31.1% None (many diffs) n/a
2 ccsbBroad304_15032 pLX_304 0% 29.8% 31.1% V5 (many diffs) n/a
3 TRCN0000466299 GCGAATTAGCAAAAGAGCGTCGAG pLX_317 29.2% 29.8% 31.1% V5 (many diffs) n/a
Download CSV