Transcript: Mouse NM_181420.3

Mus musculus fructosamine 3 kinase related protein (Fn3krp), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fn3krp (238024)
Length:
2028
CDS:
91..1020

Additional Resources:

NCBI RefSeq record:
NM_181420.3
NBCI Gene record:
Fn3krp (238024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025420 CCAGAGTTATGACACGGACAA pLKO.1 174 CDS 100% 4.050 5.670 N Fn3krp n/a
2 TRCN0000025423 GAGCATTTGGACATGCGGTAT pLKO.1 355 CDS 100% 4.050 5.670 N Fn3krp n/a
3 TRCN0000025419 GCAGAAGAATTGGGTCGAATT pLKO.1 570 CDS 100% 0.000 0.000 N Fn3krp n/a
4 TRCN0000362238 AGAGTTATGACACGGACAAAG pLKO_005 176 CDS 100% 10.800 7.560 N Fn3krp n/a
5 TRCN0000362313 GATCAAGTCTTAGCATCATAC pLKO_005 1093 3UTR 100% 10.800 7.560 N Fn3krp n/a
6 TRCN0000362310 GTGACCTGACTCCAACGATTT pLKO_005 1150 3UTR 100% 10.800 7.560 N Fn3krp n/a
7 TRCN0000362311 TGGCAATAGCGGGCATGTTTG pLKO_005 827 CDS 100% 10.800 7.560 N Fn3krp n/a
8 TRCN0000025421 CCAGGATTTGAGAAGCGCTTA pLKO.1 901 CDS 100% 4.050 2.835 N Fn3krp n/a
9 TRCN0000025422 CTCTCTAAACATAATGAGGAA pLKO.1 987 CDS 100% 2.640 1.848 N Fn3krp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04105 pDONR223 100% 85.3% 88.9% None (many diffs) n/a
2 ccsbBroad304_04105 pLX_304 0% 85.3% 88.9% V5 (many diffs) n/a
3 TRCN0000472673 TAGCCTAGTGAACTATCGACAGGA pLX_317 39% 85.3% 88.9% V5 (many diffs) n/a
4 ccsbBroadEn_15149 pDONR223 0% 85.3% 88.9% None (many diffs) n/a
5 ccsbBroad304_15149 pLX_304 0% 85.3% 88.9% V5 (many diffs) n/a
6 TRCN0000474190 GTAATTAAAGATTTTCAGTGGGGG pLX_317 44.3% 85.3% 88.9% V5 (many diffs) n/a
Download CSV