Transcript: Human NM_181673.3

Homo sapiens O-linked N-acetylglucosamine (GlcNAc) transferase (OGT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
OGT (8473)
Length:
5405
CDS:
197..3307

Additional Resources:

NCBI RefSeq record:
NM_181673.3
NBCI Gene record:
OGT (8473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035068 CCATTATTGTAACCACCCGTT pLKO.1 2643 CDS 100% 2.160 3.024 N OGT n/a
2 TRCN0000110398 CCTCTGTTCAACACCAAACAA pLKO.1 3179 CDS 100% 5.625 4.500 N Ogt n/a
3 TRCN0000332591 CCTCTGTTCAACACCAAACAA pLKO_005 3179 CDS 100% 5.625 4.500 N Ogt n/a
4 TRCN0000035067 GCTGAGCAGTATTCCGAGAAA pLKO.1 2231 CDS 100% 4.950 3.960 N OGT n/a
5 TRCN0000286200 GCTGAGCAGTATTCCGAGAAA pLKO_005 2231 CDS 100% 4.950 3.960 N OGT n/a
6 TRCN0000298541 TGTTGCAGATGGGTGATATAT pLKO_005 3407 3UTR 100% 15.000 10.500 N OGT n/a
7 TRCN0000293652 TTTAGCACTCTGGCAATTAAA pLKO_005 395 CDS 100% 15.000 10.500 N OGT n/a
8 TRCN0000035066 CCAAACTTTCTGGATGCTTAT pLKO.1 830 CDS 100% 10.800 7.560 N OGT n/a
9 TRCN0000286201 CCAAACTTTCTGGATGCTTAT pLKO_005 830 CDS 100% 10.800 7.560 N OGT n/a
10 TRCN0000035064 GCCCTAAGTTTGAGTCCAAAT pLKO.1 917 CDS 100% 10.800 7.560 N OGT n/a
11 TRCN0000286199 GCCCTAAGTTTGAGTCCAAAT pLKO_005 917 CDS 100% 10.800 7.560 N OGT n/a
12 TRCN0000035065 GCCAATCATTTCATTGATCTT pLKO.1 1991 CDS 100% 4.950 3.465 N OGT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467726 CGACGCTTGCAGTCTCACCATATG pLX_317 13.7% 99.8% .6% V5 (not translated due to prior stop codon) 18_19insAA;22G>N;2549T>C n/a
Download CSV