Transcript: Human NM_181698.4

Homo sapiens cyclin Y (CCNY), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
CCNY (219771)
Length:
4683
CDS:
323..1186

Additional Resources:

NCBI RefSeq record:
NM_181698.4
NBCI Gene record:
CCNY (219771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181698.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147455 GTCAACCAAACCTCAAGTATA pLKO.1 495 CDS 100% 13.200 18.480 N CCNY n/a
2 TRCN0000148204 GCGCAGACTTCCAAATAAATA pLKO.1 1714 3UTR 100% 15.000 10.500 N CCNY n/a
3 TRCN0000146675 CAGGACAAATAGCAAGGAAAT pLKO.1 432 CDS 100% 10.800 7.560 N CCNY n/a
4 TRCN0000180328 CGCTGTCTTCTGAGCTTTCTT pLKO.1 1768 3UTR 100% 5.625 3.938 N CCNY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181698.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05228 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05228 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492295 CACGAGTGGCAGCAAAAACTGTGA pLX_317 45.2% 100% 100% V5 n/a
Download CSV