Transcript: Human NM_181809.4

Homo sapiens bone morphogenetic protein 8a (BMP8A), mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
BMP8A (353500)
Length:
5636
CDS:
357..1565

Additional Resources:

NCBI RefSeq record:
NM_181809.4
NBCI Gene record:
BMP8A (353500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181809.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430906 AGGGTGCAGTTAGCATATTAG pLKO_005 2046 3UTR 100% 13.200 9.240 N BMP8A n/a
2 TRCN0000420333 AGCACAGAAGTCCTATCTTAG pLKO_005 1831 3UTR 100% 10.800 7.560 N BMP8A n/a
3 TRCN0000413061 AGGTACAACACTGGCCATTTC pLKO_005 1960 3UTR 100% 10.800 7.560 N BMP8A n/a
4 TRCN0000058273 CCAAGGCTACTCAGCCTATTA pLKO.1 1322 CDS 100% 1.320 0.792 N BMP8A n/a
5 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4744 3UTR 100% 10.800 5.400 Y MRPS16 n/a
6 TRCN0000058276 AGGGAGTCTGACTTGTTCTTT pLKO.1 879 CDS 100% 5.625 2.813 Y BMP8A n/a
7 TRCN0000058489 GCCACCTCTGTGCTCTACTAT pLKO.1 1476 CDS 100% 5.625 2.813 Y BMP8B n/a
8 TRCN0000058492 CTACTATGACAGCAGCAACAA pLKO.1 1490 CDS 100% 4.950 2.475 Y BMP8B n/a
9 TRCN0000058275 CATTGGAAGGAGTTCCGCTTT pLKO.1 726 CDS 100% 4.050 2.025 Y BMP8A n/a
10 TRCN0000058488 CCTGTAATTTACCTGCTGGAA pLKO.1 3112 3UTR 100% 2.640 1.320 Y BMP8B n/a
11 TRCN0000058274 GCTCTACTATGACAGCAGCAA pLKO.1 1487 CDS 100% 2.640 1.320 Y BMP8A n/a
12 TRCN0000058491 CCATTGGAAGGAGTTCCGCTT pLKO.1 725 CDS 100% 2.160 1.080 Y BMP8B n/a
13 TRCN0000058277 GCACCGCAACATGGTGGTCAA pLKO.1 1526 CDS 100% 1.350 0.675 Y BMP8A n/a
14 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4744 3UTR 100% 10.800 5.400 Y CD3EAP n/a
15 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2359 3UTR 100% 1.080 0.540 Y GPR83 n/a
16 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2359 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181809.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.