Transcript: Human NM_181836.6

Homo sapiens transmembrane p24 trafficking protein 7 (TMED7), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TMED7 (51014)
Length:
3918
CDS:
245..919

Additional Resources:

NCBI RefSeq record:
NM_181836.6
NBCI Gene record:
TMED7 (51014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181836.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430147 ATCTACTCTTCGCACACTAAA pLKO_005 1182 3UTR 100% 13.200 18.480 N TMED7 n/a
2 TRCN0000065130 CCACAACTCGTGTTGGATCAT pLKO.1 897 CDS 100% 4.950 6.930 N TMED7 n/a
3 TRCN0000415372 GTTAGCATAGGGCAGGTATTT pLKO_005 842 CDS 100% 13.200 9.240 N TMED7 n/a
4 TRCN0000417870 TACTCTGTTCGCAGTTGTTTA pLKO_005 1160 3UTR 100% 13.200 9.240 N TMED7 n/a
5 TRCN0000065131 GCCGAGCAGAGGATCTAAATA pLKO.1 774 CDS 100% 15.000 7.500 Y TMED7 n/a
6 TRCN0000065129 GTGGTCACTATGATGTAGATT pLKO.1 447 CDS 100% 5.625 2.813 Y TMED7 n/a
7 TRCN0000065132 CGAAGCTCTGAAGTCTGTCAT pLKO.1 709 CDS 100% 4.950 2.475 Y TMED7 n/a
8 TRCN0000065128 GCCTGTGTTTCAATTCACGAA pLKO.1 692 CDS 100% 2.640 1.320 Y TMED7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181836.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03173 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03173 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473021 CGACTCCACAACAGGGAATAATTT pLX_317 77.4% 100% 100% V5 n/a
Download CSV