Transcript: Human NM_182527.3

Homo sapiens calcium binding protein 7 (CABP7), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CABP7 (164633)
Length:
3334
CDS:
423..1070

Additional Resources:

NCBI RefSeq record:
NM_182527.3
NBCI Gene record:
CABP7 (164633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438333 TGCGCAGTGGCATGAAGTAGA pLKO_005 1051 CDS 100% 4.950 3.960 N CABP7 n/a
2 TRCN0000097918 GTCCATGAAGGACATAGAGAA pLKO.1 857 CDS 100% 4.950 3.465 N Cabp7 n/a
3 TRCN0000054278 GCACCGACTTTGATACTGTCT pLKO.1 760 CDS 100% 2.640 1.848 N CABP7 n/a
4 TRCN0000054282 GCCTTCAAGGTGTTTGACCGT pLKO.1 543 CDS 100% 0.660 0.462 N CABP7 n/a
5 TRCN0000054281 CGCCTTCATCATCAGTGTCAT pLKO.1 1007 CDS 100% 4.950 2.970 N CABP7 n/a
6 TRCN0000428966 CATCATCAGTGTCATGCTCAT pLKO_005 1013 CDS 100% 4.050 2.430 N Cabp7 n/a
7 TRCN0000054280 TCAAGTGGACTTTGAGGAGTT pLKO.1 683 CDS 100% 4.050 2.430 N CABP7 n/a
8 TRCN0000054279 CCTGTCCATGAAGGACATAGA pLKO.1 854 CDS 100% 0.495 0.297 N CABP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05132 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05132 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466356 GTAGACCCTATCTTCCATAATCCG pLX_317 64.2% 100% 100% V5 n/a
Download CSV