Transcript: Human NM_182529.3

Homo sapiens THAP domain containing 5 (THAP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
THAP5 (168451)
Length:
3510
CDS:
402..1463

Additional Resources:

NCBI RefSeq record:
NM_182529.3
NBCI Gene record:
THAP5 (168451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135501 GAAGTCTTTGGAAGCTCTTAT pLKO.1 1352 CDS 100% 13.200 9.240 N THAP5 n/a
2 TRCN0000135646 GACATTGAAGACTCCTTGTAT pLKO.1 1179 CDS 100% 5.625 3.938 N THAP5 n/a
3 TRCN0000136185 GCCAAACCAAACTACATGTAA pLKO.1 1509 3UTR 100% 5.625 3.938 N THAP5 n/a
4 TRCN0000136475 CAGAAAGTCTCTAAGCTACAT pLKO.1 1281 CDS 100% 4.950 3.465 N THAP5 n/a
5 TRCN0000135323 CTTGAAGTAACTACCAGTCAT pLKO.1 948 CDS 100% 4.950 3.465 N THAP5 n/a
6 TRCN0000136008 GAAATGGAAGACACAGACATT pLKO.1 1164 CDS 100% 4.950 3.465 N THAP5 n/a
7 TRCN0000135573 GAAGTAACTACCAGTCATCTT pLKO.1 951 CDS 100% 4.950 3.465 N THAP5 n/a
8 TRCN0000135647 GACTCCTTGTATAAGGATGTA pLKO.1 1188 CDS 100% 0.495 0.347 N THAP5 n/a
9 TRCN0000136234 GAAATAAAGTCAGCACAGGAA pLKO.1 1002 CDS 100% 2.640 1.320 Y THAP5 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2356 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2356 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.