Transcript: Human NM_182554.4

Homo sapiens chromosome 10 open reading frame 53 (C10orf53), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C10orf53 (282966)
Length:
2165
CDS:
48..521

Additional Resources:

NCBI RefSeq record:
NM_182554.4
NBCI Gene record:
C10orf53 (282966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182554.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135830 CATGGTGAATGAAGAAGTCAT pLKO.1 212 CDS 100% 4.950 3.960 N C10orf53 n/a
2 TRCN0000421207 GTACTGTATTGGCCCAGATTG pLKO_005 397 CDS 100% 10.800 7.560 N C10orf53 n/a
3 TRCN0000433181 TGAAATCGACAGGACAGATTG pLKO_005 519 CDS 100% 10.800 7.560 N C10orf53 n/a
4 TRCN0000136583 CCCAAGCTGTTTAACTGGATT pLKO.1 873 3UTR 100% 4.950 3.465 N C10orf53 n/a
5 TRCN0000437637 CGAACCTCTCCAGCTAGATGT pLKO_005 643 3UTR 100% 4.950 3.465 N C10orf53 n/a
6 TRCN0000133780 CAACATTAAGGACTTGGAGTT pLKO.1 242 CDS 100% 4.050 2.835 N C10orf53 n/a
7 TRCN0000138253 CCAATCTTTGTGACCTGGGTT pLKO.1 439 CDS 100% 2.640 1.848 N C10orf53 n/a
8 TRCN0000136986 CTTTGCAACAGTTCCCACAAA pLKO.1 358 CDS 100% 4.950 2.970 N C10orf53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182554.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09932 pDONR223 100% 99.3% 98.7% None 216C>T;295A>G;353C>T n/a
2 ccsbBroad304_09932 pLX_304 0% 99.3% 98.7% V5 216C>T;295A>G;353C>T n/a
3 TRCN0000478860 GTCAGTGCAGGGATTAACGTATAA pLX_317 76.9% 99.3% 98.7% V5 216C>T;295A>G;353C>T n/a
Download CSV