Transcript: Human NM_182572.4

Homo sapiens zinc finger and SCAN domain containing 1 (ZSCAN1), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
ZSCAN1 (284312)
Length:
2095
CDS:
289..1515

Additional Resources:

NCBI RefSeq record:
NM_182572.4
NBCI Gene record:
ZSCAN1 (284312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432013 TGTTGCAGGCATCTCGGTAGT pLKO_005 1113 CDS 100% 4.050 5.670 N ZSCAN1 n/a
2 TRCN0000015939 CCATCCCTCAAGCACACCAAA pLKO.1 1075 CDS 100% 4.950 3.465 N ZSCAN1 n/a
3 TRCN0000433272 ATGTGCCAGCAGGAAGTTCTG pLKO_005 643 CDS 100% 4.050 2.835 N ZSCAN1 n/a
4 TRCN0000422296 CACAAGCTGTTTCTCGGAAGA pLKO_005 1641 3UTR 100% 4.050 2.835 N ZSCAN1 n/a
5 TRCN0000015941 CCACTTCATCGAGCACCAGAA pLKO.1 1203 CDS 100% 4.050 2.835 N ZSCAN1 n/a
6 TRCN0000015940 GAAGAGTCCAAGGTCCCAGAA pLKO.1 720 CDS 100% 4.050 2.835 N ZSCAN1 n/a
7 TRCN0000015938 CCCTGGATGGTCCACCTCATT pLKO.1 1456 CDS 100% 1.650 0.990 N ZSCAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13523 pDONR223 100% 39.6% 32.9% None (many diffs) n/a
2 ccsbBroad304_13523 pLX_304 0% 39.6% 32.9% V5 (many diffs) n/a
3 TRCN0000471331 AGCATCAGCGTCTGGCTGGGGGAA pLX_317 77.6% 39.6% 32.9% V5 (many diffs) n/a
Download CSV