Transcript: Human NM_182592.2

Homo sapiens Yip1 domain family member 7 (YIPF7), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
YIPF7 (285525)
Length:
937
CDS:
18..860

Additional Resources:

NCBI RefSeq record:
NM_182592.2
NBCI Gene record:
YIPF7 (285525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129649 CATTATGAATGAAACGGACCT pLKO.1 446 CDS 100% 2.160 3.024 N YIPF7 n/a
2 TRCN0000424327 AGCATCCAACTCAGATTATTA pLKO_005 296 CDS 100% 15.000 10.500 N YIPF7 n/a
3 TRCN0000414726 ACATTTACTGGAGGATCTTTC pLKO_005 50 CDS 100% 10.800 7.560 N YIPF7 n/a
4 TRCN0000129680 CTACATTTACTGGAGGATCTT pLKO.1 48 CDS 100% 4.950 3.465 N YIPF7 n/a
5 TRCN0000131210 GATGCTCATGTCATCGGGTTA pLKO.1 254 CDS 100% 4.050 2.835 N YIPF7 n/a
6 TRCN0000128917 GCTAGAAGAACTTGGAATCCA pLKO.1 362 CDS 100% 3.000 2.100 N YIPF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13552 pDONR223 100% 46.2% 42.7% None 349_350insAAGAT;392_840del n/a
2 ccsbBroad304_13552 pLX_304 0% 46.2% 42.7% V5 349_350insAAGAT;392_840del n/a
3 TRCN0000467408 TGTCAGCAGAATTGCACCCACGAG pLX_317 85.9% 46.2% 42.7% V5 349_350insAAGAT;392_840del n/a
Download CSV