Transcript: Human NM_182643.3

Homo sapiens DLC1 Rho GTPase activating protein (DLC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
DLC1 (10395)
Length:
7412
CDS:
376..4962

Additional Resources:

NCBI RefSeq record:
NM_182643.3
NBCI Gene record:
DLC1 (10395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423034 GCGTACCTGTGTCGCTTTATT pLKO_005 5299 3UTR 100% 15.000 21.000 N DLC1 n/a
2 TRCN0000047824 GCAGGCGTCTAAATACTTTAA pLKO.1 1874 CDS 100% 13.200 18.480 N DLC1 n/a
3 TRCN0000047825 GCCGATGTCGTAATTCCTATA pLKO.1 4247 CDS 100% 10.800 15.120 N DLC1 n/a
4 TRCN0000047827 CATGCCAGAATGGTACACAAA pLKO.1 4848 CDS 100% 4.950 3.960 N DLC1 n/a
5 TRCN0000421791 TGGTGGGTGTGAGGGTTAATG pLKO_005 4742 CDS 100% 13.200 9.240 N DLC1 n/a
6 TRCN0000428081 TTTCTACAGATCTACCAATAT pLKO_005 3883 CDS 100% 13.200 9.240 N DLC1 n/a
7 TRCN0000421147 GATCTTCCTGAGCCACTAATG pLKO_005 3841 CDS 100% 10.800 7.560 N DLC1 n/a
8 TRCN0000047823 GCAGAAATACTCACTCCTAAA pLKO.1 3468 CDS 100% 10.800 7.560 N DLC1 n/a
9 TRCN0000047826 GCAGACATGCTGAAGCAGTAT pLKO.1 3814 CDS 100% 4.950 2.970 N DLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07596 pDONR223 100% 30% 29.5% None (many diffs) n/a
2 ccsbBroad304_07596 pLX_304 0% 30% 29.5% V5 (many diffs) n/a
3 TRCN0000468103 ATTCAACCGATCACGTAATGGTCG pLX_317 27.7% 30% 29.5% V5 (many diffs) n/a
Download CSV