Transcript: Human NM_182658.2

Homo sapiens BPI fold containing family B member 3 (BPIFB3), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
BPIFB3 (359710)
Length:
1556
CDS:
94..1524

Additional Resources:

NCBI RefSeq record:
NM_182658.2
NBCI Gene record:
BPIFB3 (359710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431307 GCCTTTGACGGATCGCGTTTA pLKO_005 1345 CDS 100% 10.800 15.120 N BPIFB3 n/a
2 TRCN0000431902 CACGGTCACACTCCACAACAA pLKO_005 1134 CDS 100% 4.950 6.930 N BPIFB3 n/a
3 TRCN0000413872 AGCGATGTCCCACTGACAACT pLKO_005 1024 CDS 100% 4.950 3.960 N BPIFB3 n/a
4 TRCN0000430089 TCGGATTGACAAGGATGAACT pLKO_005 189 CDS 100% 4.950 3.960 N BPIFB3 n/a
5 TRCN0000179215 GAAGAGTGTAGCTGGTGATAT pLKO.1 846 CDS 100% 13.200 9.240 N BPIFB3 n/a
6 TRCN0000156160 CCAACATCCATGTGCTGTTCT pLKO.1 1178 CDS 100% 4.950 3.465 N BPIFB3 n/a
7 TRCN0000155512 CGTGGAACAGATGCTCTTCAA pLKO.1 648 CDS 100% 4.950 3.465 N BPIFB3 n/a
8 TRCN0000101016 GCTCGGATTGACAAGGATGAA pLKO.1 187 CDS 100% 4.950 3.465 N Bpifb3 n/a
9 TRCN0000155541 GCAGTGTATGCACCAAAGCTT pLKO.1 1393 CDS 100% 3.000 2.100 N BPIFB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10063 pDONR223 100% 99.8% 99.5% None 869C>T;1345C>T n/a
2 ccsbBroad304_10063 pLX_304 0% 99.8% 99.5% V5 869C>T;1345C>T n/a
3 TRCN0000467197 TCGCAACTATATGAGTGTACCTCC pLX_317 22.5% 99.8% 99.5% V5 869C>T;1345C>T n/a
Download CSV