Transcript: Mouse NM_182745.2

Mus musculus RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
1700028K03Rik (76421)
Length:
795
CDS:
118..678

Additional Resources:

NCBI RefSeq record:
NM_182745.2
NBCI Gene record:
1700028K03Rik (76421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_182745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264648 AGTGGACAACCACCATTATTA pLKO_005 155 CDS 100% 15.000 21.000 N 1700028K03Rik n/a
2 TRCN0000216177 CAACTAAAGCGTACATCATAG pLKO.1 581 CDS 100% 10.800 15.120 N 1700028K03Rik n/a
3 TRCN0000283112 CAACTAAAGCGTACATCATAG pLKO_005 581 CDS 100% 10.800 15.120 N 1700028K03Rik n/a
4 TRCN0000184516 GAAGCCACAAGGTTCGGTATT pLKO.1 224 CDS 100% 10.800 15.120 N 1700028K03Rik n/a
5 TRCN0000264650 TTGGGCAGTAACTTACGAATA pLKO_005 460 CDS 100% 10.800 15.120 N 1700028K03Rik n/a
6 TRCN0000215823 CTCTTAAGAGTTACGAAATTG pLKO.1 185 CDS 100% 13.200 9.240 N 1700028K03Rik n/a
7 TRCN0000264649 CTCTTAAGAGTTACGAAATTG pLKO_005 185 CDS 100% 13.200 9.240 N 1700028K03Rik n/a
8 TRCN0000264651 TTGACCTTATGTGCACTATAG pLKO_005 509 CDS 100% 10.800 7.560 N 1700028K03Rik n/a
9 TRCN0000180838 GATGGATGCTAAGGAGTGTAT pLKO.1 303 CDS 100% 4.950 3.465 N 1700028K03Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05589 pDONR223 100% 82.5% 80.6% None (many diffs) n/a
2 ccsbBroad304_05589 pLX_304 0% 82.5% 80.6% V5 (many diffs) n/a
3 TRCN0000474622 AATGCTTAAACCACGGCACACCAT pLX_317 85% 82.5% 80.6% V5 (many diffs) n/a
Download CSV