Transcript: Human NM_182751.3

Homo sapiens minichromosome maintenance 10 replication initiation factor (MCM10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MCM10 (55388)
Length:
4552
CDS:
125..2752

Additional Resources:

NCBI RefSeq record:
NM_182751.3
NBCI Gene record:
MCM10 (55388)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245427 AGATGCAGGAGCGCTACTTTG pLKO_005 2376 CDS 100% 10.800 8.640 N MCM10 n/a
2 TRCN0000245424 CCTAAGGTTATGTCCTAATAA pLKO_005 4120 3UTR 100% 15.000 10.500 N MCM10 n/a
3 TRCN0000245426 GACGGCGACGGTGAATCTTAT pLKO_005 269 CDS 100% 13.200 9.240 N MCM10 n/a
4 TRCN0000167692 GCCAGATTTCTTCATTCAATT pLKO.1 3324 3UTR 100% 13.200 9.240 N MCM10 n/a
5 TRCN0000245428 GGGATAACTAGAGGTCAAATT pLKO_005 797 CDS 100% 13.200 9.240 N MCM10 n/a
6 TRCN0000245425 TCATCCTCAGAAGGTCTTAAT pLKO_005 1243 CDS 100% 13.200 9.240 N MCM10 n/a
7 TRCN0000168198 CCACTGAATCACTTTGCATTT pLKO.1 3381 3UTR 100% 10.800 7.560 N MCM10 n/a
8 TRCN0000168342 GCTAAATTTCTGAACAGCCTT pLKO.1 2726 CDS 100% 2.640 1.848 N MCM10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12217 pDONR223 100% 40.3% 40.2% None 1_1566del;1621A>T n/a
2 ccsbBroad304_12217 pLX_304 0% 40.3% 40.2% V5 1_1566del;1621A>T n/a
3 TRCN0000473881 ATGAAATTCTATAAGATGGAGAAA pLX_317 53.1% 40.3% 40.2% V5 1_1566del;1621A>T n/a
Download CSV