Transcript: Mouse NM_183019.2

Mus musculus Rho guanine nucleotide exchange factor (GEF) 4 (Arhgef4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Arhgef4 (226970)
Length:
2738
CDS:
335..1789

Additional Resources:

NCBI RefSeq record:
NM_183019.2
NBCI Gene record:
Arhgef4 (226970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110032 CGCCAGCTCATCTACTGTAAA pLKO.1 1292 CDS 100% 13.200 18.480 N Arhgef4 n/a
2 TRCN0000110031 CGGGAGGATATGTTCAGTGAA pLKO.1 665 CDS 100% 4.950 6.930 N Arhgef4 n/a
3 TRCN0000110034 GCTGCAAAGGATGATTGACAT pLKO.1 937 CDS 100% 4.950 6.930 N Arhgef4 n/a
4 TRCN0000110033 CAGCTCATCAACGAACGGAAA pLKO.1 1103 CDS 100% 4.050 3.240 N Arhgef4 n/a
5 TRCN0000110030 GCTCTGGACATTCTTTGGAAA pLKO.1 2070 3UTR 100% 4.950 3.465 N Arhgef4 n/a
6 TRCN0000047559 GCTCAGCAAGTACGTGTACTT pLKO.1 898 CDS 100% 0.495 0.347 N ARHGEF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.