Transcript: Mouse NM_183028.3

Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 (Pcmtd1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pcmtd1 (319263)
Length:
5235
CDS:
413..1486

Additional Resources:

NCBI RefSeq record:
NM_183028.3
NBCI Gene record:
Pcmtd1 (319263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236080 GTACAATGGTGGGCTTAATTT pLKO_005 696 CDS 100% 15.000 21.000 N PCMTD1 n/a
2 TRCN0000250371 GTACAATGGTGGGCTTAATTT pLKO_005 696 CDS 100% 15.000 21.000 N Pcmtd1 n/a
3 TRCN0000236084 TCATCAGTATGATCGAATTTA pLKO_005 883 CDS 100% 15.000 21.000 N PCMTD1 n/a
4 TRCN0000258042 TCATCAGTATGATCGAATTTA pLKO_005 883 CDS 100% 15.000 21.000 N Pcmtd1 n/a
5 TRCN0000250372 CATCGAGACACCGGACTTAAA pLKO_005 4465 3UTR 100% 13.200 18.480 N Pcmtd1 n/a
6 TRCN0000258026 CCAAGACTTGGCTCGCATTTA pLKO_005 1141 CDS 100% 13.200 18.480 N Pcmtd1 n/a
7 TRCN0000216493 GTCATCAGTATGATCGAATTT pLKO.1 882 CDS 100% 13.200 18.480 N Pcmtd1 n/a
8 TRCN0000192779 CGAACTGAAAGAGTAGAGCAA pLKO.1 485 CDS 100% 2.640 3.696 N Pcmtd1 n/a
9 TRCN0000236082 GGAAGTGGAACCGGATATTTA pLKO_005 674 CDS 100% 15.000 10.500 N PCMTD1 n/a
10 TRCN0000189986 GCTCAGTACATCCGAACTGAA pLKO.1 473 CDS 100% 0.495 0.347 N Pcmtd1 n/a
11 TRCN0000236083 TGCCTATAGAGGATCAGTTAA pLKO_005 978 CDS 100% 13.200 18.480 N PCMTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09416 pDONR223 100% 92.6% 98.5% None (many diffs) n/a
2 TRCN0000470013 AAACCACTCCTAACGATAACTAAC pLX_317 28.4% 92.6% 98.5% V5 (many diffs) n/a
Download CSV