Transcript: Mouse NM_183064.5

Mus musculus fibroblast growth factor 12 (Fgf12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Fgf12 (14167)
Length:
6250
CDS:
885..1616

Additional Resources:

NCBI RefSeq record:
NM_183064.5
NBCI Gene record:
Fgf12 (14167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058474 GACTCAATAAAGAAGGTCAAA pLKO.1 1411 CDS 100% 4.950 3.960 N FGF12 n/a
2 TRCN0000066838 GCATGGTTTCTAGGACTCAAT pLKO.1 1398 CDS 100% 4.950 3.960 N Fgf12 n/a
3 TRCN0000066840 CGTGAATCAAGATTCTACATA pLKO.1 1595 CDS 100% 5.625 3.938 N Fgf12 n/a
4 TRCN0000066842 CCCACCATGAATGGAGGCAAA pLKO.1 1572 CDS 100% 4.050 2.835 N Fgf12 n/a
5 TRCN0000066841 CTCTTCAATCTAATTCCTGTA pLKO.1 1197 CDS 100% 4.050 2.835 N Fgf12 n/a
6 TRCN0000066839 GCCATGAATGGAGAAGGCTAT pLKO.1 1266 CDS 100% 4.050 2.430 N Fgf12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06210 pDONR223 100% 68.1% 72.4% None (many diffs) n/a
2 ccsbBroad304_06210 pLX_304 0% 68.1% 72.4% V5 (many diffs) n/a
3 TRCN0000473712 GAGGGATGGAATACATTTCCAACG pLX_317 100% 68.1% 72.4% V5 (many diffs) n/a
Download CSV