Transcript: Mouse NM_183154.3

Mus musculus zinc finger, FYVE domain containing 1 (Zfyve1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zfyve1 (217695)
Length:
3869
CDS:
594..2927

Additional Resources:

NCBI RefSeq record:
NM_183154.3
NBCI Gene record:
Zfyve1 (217695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098538 CAGTATGACAACCGCGTCTAT pLKO.1 1983 CDS 100% 4.950 6.930 N Zfyve1 n/a
2 TRCN0000098537 CCGGCTGCATAATGACCTCTT pLKO.1 1403 CDS 100% 4.050 5.670 N Zfyve1 n/a
3 TRCN0000098539 GAAGAGATCCAGGTAACAAAT pLKO.1 1065 CDS 100% 13.200 9.240 N Zfyve1 n/a
4 TRCN0000098535 CGACTGCTTCACAATTCCTTA pLKO.1 2943 3UTR 100% 4.950 3.465 N Zfyve1 n/a
5 TRCN0000098536 GCTGCATAATGACCTCTTCAA pLKO.1 1406 CDS 100% 4.950 3.465 N Zfyve1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03388 pDONR223 100% 90.1% 96.6% None (many diffs) n/a
2 ccsbBroad304_03388 pLX_304 0% 90.1% 96.6% V5 (many diffs) n/a
3 TRCN0000474008 TAATCGAAAAGCGATACAGCGACG pLX_317 16.1% 90.1% 96.6% V5 (many diffs) n/a
Download CSV