Transcript: Mouse NM_183165.3

Mus musculus pyridine nucleotide-disulphide oxidoreductase domain 1 (Pyroxd1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pyroxd1 (232491)
Length:
2155
CDS:
37..1533

Additional Resources:

NCBI RefSeq record:
NM_183165.3
NBCI Gene record:
Pyroxd1 (232491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200899 CATGGGACATCCTATTGACAT pLKO.1 1212 CDS 100% 4.950 6.930 N Pyroxd1 n/a
2 TRCN0000192866 GAGCCGTCTTAATTGGTGAAA pLKO.1 1403 CDS 100% 4.950 6.930 N Pyroxd1 n/a
3 TRCN0000201372 GCCATAAAGGATAACGCCATT pLKO.1 547 CDS 100% 4.050 5.670 N Pyroxd1 n/a
4 TRCN0000192267 CAGAGGACAAGAGTATGTCAA pLKO.1 1353 CDS 100% 4.950 3.465 N Pyroxd1 n/a
5 TRCN0000191810 GAACCAAATCTAAAGCTGATT pLKO.1 695 CDS 100% 4.950 2.970 N Pyroxd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04147 pDONR223 100% 82.8% 84.8% None (many diffs) n/a
2 ccsbBroad304_04147 pLX_304 0% 82.8% 84.8% V5 (many diffs) n/a
3 TRCN0000472946 CTCATCCCTGCACTGGGAGCTTCC pLX_317 26.3% 82.8% 84.8% V5 (many diffs) n/a
Download CSV