Transcript: Mouse NM_183167.4

Mus musculus expressed sequence AI987944 (AI987944), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
AI987944 (233168)
Length:
2664
CDS:
32..1252

Additional Resources:

NCBI RefSeq record:
NM_183167.4
NBCI Gene record:
AI987944 (233168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191329 CCAATTTATATTGCAGAGGAA pLKO.1 1296 3UTR 100% 2.640 3.696 N AI987944 n/a
2 TRCN0000191294 CCTTTGTGTGTAGTCTTAGAA pLKO.1 1267 3UTR 100% 5.625 3.938 N AI987944 n/a
3 TRCN0000201373 GAACCAATGTGGTCAAGGTAA pLKO.1 511 CDS 100% 4.950 3.465 N AI987944 n/a
4 TRCN0000191840 GAAGACCATAATAGTGAACAT pLKO.1 173 CDS 100% 4.950 3.465 N AI987944 n/a
5 TRCN0000192817 GCACATCAAAGTCACCTTCAA pLKO.1 365 CDS 100% 4.950 3.465 N AI987944 n/a
6 TRCN0000217081 CAACACAGTTATCTCCGAACA pLKO.1 1193 CDS 100% 4.050 2.835 N AI987944 n/a
7 TRCN0000201752 GCACGCCATAGTCATCTTCTA pLKO.1 1022 CDS 100% 4.950 2.970 N AI987944 n/a
8 TRCN0000192359 CGTAGTTACCTTCGAAAGCAT pLKO.1 455 CDS 100% 3.000 1.800 N AI987944 n/a
9 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 977 CDS 100% 15.000 7.500 Y Gm10771 n/a
10 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 977 CDS 100% 15.000 7.500 Y ZNF286B n/a
11 TRCN0000215374 CTAGAGAGAAACCCTATAAAT pLKO.1 1230 CDS 100% 15.000 7.500 Y AI987944 n/a
12 TRCN0000216285 CAATAGTCTCCAAGTACATAA pLKO.1 610 CDS 100% 13.200 6.600 Y AI987944 n/a
13 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 642 CDS 100% 13.200 6.600 Y Zfp934 n/a
14 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 642 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
15 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 642 CDS 100% 13.200 6.600 Y EG668616 n/a
16 TRCN0000175115 GAATGTAATCAGTGTGGTAAA pLKO.1 827 CDS 100% 10.800 5.400 Y Zfp935 n/a
17 TRCN0000021816 CTGGAGAGAAACCTTACAGAT pLKO.1 1062 CDS 100% 4.950 2.475 Y ZNF253 n/a
18 TRCN0000155654 CTGGAGAGAAACCTTACAGAT pLKO.1 1062 CDS 100% 4.950 2.475 Y ZNF320 n/a
19 TRCN0000243746 CAATTGGGAAGACCATAATAT pLKO_005 166 CDS 100% 15.000 7.500 Y Gm6871 n/a
20 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 727 CDS 100% 13.200 6.600 Y Zfp977 n/a
21 TRCN0000193310 CCTATGAATGTAATCAGTGTA pLKO.1 570 CDS 100% 4.950 2.475 Y Zfp932 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.