Transcript: Mouse NM_183186.2

Mus musculus forkhead box N3 (Foxn3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Foxn3 (71375)
Length:
2611
CDS:
65..1438

Additional Resources:

NCBI RefSeq record:
NM_183186.2
NBCI Gene record:
Foxn3 (71375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183186.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086631 CCGTTACCAATCACTCCCATT pLKO.1 851 CDS 100% 4.050 3.240 N Foxn3 n/a
2 TRCN0000327479 CCGTTACCAATCACTCCCATT pLKO_005 851 CDS 100% 4.050 3.240 N Foxn3 n/a
3 TRCN0000086632 CTCCTTTAGCTGCCTCATATT pLKO.1 415 CDS 100% 13.200 9.240 N Foxn3 n/a
4 TRCN0000327401 CTCCTTTAGCTGCCTCATATT pLKO_005 415 CDS 100% 13.200 9.240 N Foxn3 n/a
5 TRCN0000086628 GCACACAAACACACAACTTAA pLKO.1 2300 3UTR 100% 13.200 9.240 N Foxn3 n/a
6 TRCN0000327400 GCACACAAACACACAACTTAA pLKO_005 2300 3UTR 100% 13.200 9.240 N Foxn3 n/a
7 TRCN0000306701 AGTATTGGGAAAGGGTCATTG pLKO_005 608 CDS 100% 10.800 7.560 N Foxn3 n/a
8 TRCN0000086630 TCTTAGAACATTTCCCGTATT pLKO.1 495 CDS 100% 10.800 7.560 N Foxn3 n/a
9 TRCN0000086629 CAGTACCTTCTTCAAGAGAAA pLKO.1 748 CDS 100% 4.950 3.465 N Foxn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183186.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00302 pDONR223 100% 89.8% 93.1% None (many diffs) n/a
2 ccsbBroad304_00302 pLX_304 0% 89.8% 93.1% V5 (many diffs) n/a
3 TRCN0000478836 AGGGATCATCGGATTTCCATGCCT pLX_317 25.7% 89.8% 93.1% V5 (many diffs) n/a
Download CSV