Transcript: Mouse NM_183204.4

Mus musculus ring finger protein 182 (Rnf182), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf182 (328234)
Length:
3456
CDS:
487..1230

Additional Resources:

NCBI RefSeq record:
NM_183204.4
NBCI Gene record:
Rnf182 (328234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037365 CGTCCTCTAATTGCTTGGTTA pLKO.1 857 CDS 100% 4.950 6.930 N Rnf182 n/a
2 TRCN0000037367 GCTCGAGTGTAAGATCTGTTA pLKO.1 537 CDS 100% 0.000 0.000 N Rnf182 n/a
3 TRCN0000037364 CATAGGAAACTCAGCGCATAT pLKO.1 1242 3UTR 100% 10.800 7.560 N Rnf182 n/a
4 TRCN0000414592 TCTACAAGATCATAGACTTTG pLKO_005 629 CDS 100% 10.800 7.560 N RNF182 n/a
5 TRCN0000443866 TGCCCTTAGGGATCTACTTAC pLKO_005 1076 CDS 100% 10.800 7.560 N Rnf182 n/a
6 TRCN0000037368 CTCTACAAGATCATAGACTTT pLKO.1 628 CDS 100% 4.950 3.465 N Rnf182 n/a
7 TRCN0000037366 GCTGCTAGGTTTGCTGTACTT pLKO.1 1047 CDS 100% 4.950 3.465 N Rnf182 n/a
8 TRCN0000034144 CCCGATGACAACAACATCCTT pLKO.1 730 CDS 100% 3.000 2.100 N RNF182 n/a
9 TRCN0000034146 GTGTCTAAGAAAGTCACCCTT pLKO.1 1099 CDS 100% 2.640 1.848 N RNF182 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471076 ATTTAGCTGAGTGTCTCGTTGAAC pLX_317 70.1% 88.5% 98.3% V5 (many diffs) n/a
2 ccsbBroadEn_09875 pDONR223 100% 88.3% 97.9% None (many diffs) n/a
3 ccsbBroad304_09875 pLX_304 0% 88.3% 97.9% V5 (many diffs) n/a
Download CSV