Transcript: Human NM_183374.3

Homo sapiens cytochrome P450 family 26 subfamily C member 1 (CYP26C1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CYP26C1 (340665)
Length:
2878
CDS:
467..2035

Additional Resources:

NCBI RefSeq record:
NM_183374.3
NBCI Gene record:
CYP26C1 (340665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064159 GAAACGCTGCACTGGTTAGTT pLKO.1 647 CDS 100% 5.625 7.875 N CYP26C1 n/a
2 TRCN0000064160 GATGCCCTCGACCTAATCATT pLKO.1 1259 CDS 100% 5.625 7.875 N CYP26C1 n/a
3 TRCN0000064158 ACCTAATCATTCACAGTGCAA pLKO.1 1269 CDS 100% 2.640 3.696 N CYP26C1 n/a
4 TRCN0000419667 CTACGTCGACTGCGTGGTCAA pLKO_005 1567 CDS 100% 1.350 1.890 N CYP26C1 n/a
5 TRCN0000430306 TCCCGAAGGCTTCGATCCAGA pLKO_005 1738 CDS 100% 0.880 1.232 N CYP26C1 n/a
6 TRCN0000432819 GCCATTTCTGAGAAGCTTCAC pLKO_005 1214 CDS 100% 4.050 3.240 N CYP26C1 n/a
7 TRCN0000445955 AGAGCGCTATGGGACAGTGTT pLKO_005 697 CDS 100% 4.950 3.465 N CYP26C1 n/a
8 TRCN0000064161 TCAGTCTACGACGCCTCCAAA pLKO.1 1004 CDS 100% 4.950 3.465 N CYP26C1 n/a
9 TRCN0000064162 CAGCTGCTAGCTGTGGAGCTA pLKO.1 1874 CDS 100% 0.088 0.062 N CYP26C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.