Transcript: Mouse NM_194263.2

Mus musculus T-box 20 (Tbx20), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tbx20 (57246)
Length:
6436
CDS:
459..1796

Additional Resources:

NCBI RefSeq record:
NM_194263.2
NBCI Gene record:
Tbx20 (57246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_194263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081847 AGAAGAATTCAGGACGTTCAT pLKO.1 1199 CDS 100% 0.000 0.000 N Tbx20 n/a
2 TRCN0000423003 TGGATCCTGAGTCCAAGTATA pLKO_005 874 CDS 100% 13.200 9.240 N Tbx20 n/a
3 TRCN0000081846 CCCAGCGAAGAGATGGCTAAA pLKO.1 732 CDS 100% 10.800 7.560 N Tbx20 n/a
4 TRCN0000081845 CCTCAAACAGATGGTGTCTTT pLKO.1 1043 CDS 100% 4.950 3.465 N Tbx20 n/a
5 TRCN0000081844 CCAACTGATAACCAAGCTGAA pLKO.1 1262 CDS 100% 4.050 2.835 N Tbx20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08694 pDONR223 100% 59.6% 65.2% None (many diffs) n/a
2 ccsbBroad304_08694 pLX_304 0% 59.6% 65.2% V5 (many diffs) n/a
3 TRCN0000491446 ACCTAACCTAACTACGCTTGAACG pLX_317 43.8% 59.6% 65.2% V5 (many diffs) n/a
Download CSV