Transcript: Mouse NM_197985.4

Mus musculus adiponectin receptor 2 (Adipor2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Adipor2 (68465)
Length:
4008
CDS:
198..1358

Additional Resources:

NCBI RefSeq record:
NM_197985.4
NBCI Gene record:
Adipor2 (68465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_197985.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277168 CTTCTGATGTGATCGTATTTA pLKO_005 1658 3UTR 100% 15.000 21.000 N Adipor2 n/a
2 TRCN0000175771 GCAGGAATTTCGTTTCATGAT pLKO.1 1304 CDS 100% 4.950 3.960 N Adipor2 n/a
3 TRCN0000277170 GCAGGAATTTCGTTTCATGAT pLKO_005 1304 CDS 100% 4.950 3.960 N Adipor2 n/a
4 TRCN0000277169 CTTATGGCTAGCCTCTATATC pLKO_005 1143 CDS 100% 13.200 9.240 N Adipor2 n/a
5 TRCN0000277172 GGACTCCAGAGCCAGATATAC pLKO_005 235 CDS 100% 13.200 9.240 N Adipor2 n/a
6 TRCN0000173201 CCATCATGCTATGGAACGAAT pLKO.1 449 CDS 100% 4.950 3.465 N Adipor2 n/a
7 TRCN0000277171 CCATCATGCTATGGAACGAAT pLKO_005 449 CDS 100% 4.950 3.465 N Adipor2 n/a
8 TRCN0000176423 CGGATAGAATTAAACCCACAA pLKO.1 2867 3UTR 100% 4.050 2.835 N Adipor2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_197985.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04087 pDONR223 100% 89.8% 92.7% None (many diffs) n/a
2 ccsbBroad304_04087 pLX_304 0% 89.8% 92.7% V5 (many diffs) n/a
3 TRCN0000466625 ACGAGCATACTATGGCCATGTAGA pLX_317 30% 89.8% 92.7% V5 (many diffs) n/a
Download CSV