Transcript: Human NM_198098.3

Homo sapiens aquaporin 1 (Colton blood group) (AQP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
AQP1 (358)
Length:
2914
CDS:
217..1026

Additional Resources:

NCBI RefSeq record:
NM_198098.3
NBCI Gene record:
AQP1 (358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044130 TGTACTCATCTACGACTTCAT pLKO.1 885 CDS 100% 4.950 6.930 N AQP1 n/a
2 TRCN0000044128 GATCACACACAACTTCAGCAA pLKO.1 819 CDS 100% 2.640 2.112 N AQP1 n/a
3 TRCN0000044129 CACGACCCTCTTTGTCTTCAT pLKO.1 276 CDS 100% 4.950 3.465 N AQP1 n/a
4 TRCN0000044131 CCGTGCCCTCATGTACATCAT pLKO.1 492 CDS 100% 4.950 3.465 N AQP1 n/a
5 TRCN0000044132 AGGGTGGAGATGAAGCCCAAA pLKO.1 1003 CDS 100% 4.050 2.835 N AQP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05841 pDONR223 100% 99.8% 99.6% None 133G>A n/a
2 ccsbBroad304_05841 pLX_304 0% 99.8% 99.6% V5 133G>A n/a
3 TRCN0000475825 TATTCACATATGCACATGCTATTT pLX_317 38.6% 99.8% 99.6% V5 133G>A n/a
Download CSV