Transcript: Human NM_198148.3

Homo sapiens carboxypeptidase X, M14 family member 2 (CPXM2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CPXM2 (119587)
Length:
3544
CDS:
149..2419

Additional Resources:

NCBI RefSeq record:
NM_198148.3
NBCI Gene record:
CPXM2 (119587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073886 GCAGGTTCATCGTGGCATTAA pLKO.1 2062 CDS 100% 13.200 18.480 N CPXM2 n/a
2 TRCN0000073885 CCACGATGGAATTGACATCAA pLKO.1 1486 CDS 100% 4.950 6.930 N CPXM2 n/a
3 TRCN0000073884 CCCTCAGTCCTGGTTTGATAA pLKO.1 970 CDS 100% 13.200 9.240 N CPXM2 n/a
4 TRCN0000073883 GCTGAGATCATTCAGGAGTTT pLKO.1 3044 3UTR 100% 4.950 3.465 N CPXM2 n/a
5 TRCN0000073887 TGTCCCAATATCACCAGAATT pLKO.1 1151 CDS 100% 0.000 0.000 N CPXM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09463 pDONR223 100% 99.8% 99.8% None 1575C>T;1632C>T;2249A>G n/a
2 ccsbBroad304_09463 pLX_304 0% 99.8% 99.8% V5 1575C>T;1632C>T;2249A>G n/a
3 TRCN0000475417 CACGCTTTGGTTGTTCGATGCTAA pLX_317 10.6% 99.8% 99.8% V5 1575C>T;1632C>T;2249A>G n/a
Download CSV