Transcript: Mouse NM_198161.2

Mus musculus basic helix-loop-helix domain containing, class B9 (Bhlhb9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bhlhb9 (70237)
Length:
2843
CDS:
785..2404

Additional Resources:

NCBI RefSeq record:
NM_198161.2
NBCI Gene record:
Bhlhb9 (70237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215733 CAATACTCTTACAGCCATATT pLKO.1 2350 CDS 100% 13.200 10.560 N Bhlhb9 n/a
2 TRCN0000217932 GAGGAGGAAGAGAACGTTATT pLKO.1 1283 CDS 100% 13.200 9.240 N Bhlhb9 n/a
3 TRCN0000217062 CACAGATTGCAATGGGTATAC pLKO.1 1791 CDS 100% 10.800 7.560 N Bhlhb9 n/a
4 TRCN0000194138 GCTGGAGAAGATTCTGGTATT pLKO.1 1121 CDS 100% 10.800 7.560 N Bhlhb9 n/a
5 TRCN0000176118 GCGTGGTGACACTTATTGAAA pLKO.1 1854 CDS 100% 5.625 3.938 N Bhlhb9 n/a
6 TRCN0000176368 CCATAGGACTGAGAACAAGTT pLKO.1 1051 CDS 100% 4.950 3.465 N Bhlhb9 n/a
7 TRCN0000174307 CCAGAAATTAAAGAGAACACT pLKO.1 2411 3UTR 100% 3.000 2.100 N Bhlhb9 n/a
8 TRCN0000176315 CTAGCTCAAAGCTAGACCATT pLKO.1 2553 3UTR 100% 0.495 0.347 N Bhlhb9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.