Transcript: Mouse NM_198191.3

Mus musculus phosphatidylinositol-4-phosphate 5-kinase-like 1 (Pip5kl1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pip5kl1 (227733)
Length:
1578
CDS:
148..1335

Additional Resources:

NCBI RefSeq record:
NM_198191.3
NBCI Gene record:
Pip5kl1 (227733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025102 AGCACATTCAAGTCCATACAA pLKO.1 1057 CDS 100% 5.625 7.875 N Pip5kl1 n/a
2 TRCN0000025099 GCTGCATAGAATGACACGAAT pLKO.1 303 CDS 100% 4.950 6.930 N Pip5kl1 n/a
3 TRCN0000025100 GTGTGGAAGATGGTACGCTAT pLKO.1 1234 CDS 100% 4.050 5.670 N Pip5kl1 n/a
4 TRCN0000362177 TGGATATGACTACCGTGTATG pLKO_005 1190 CDS 100% 10.800 8.640 N Pip5kl1 n/a
5 TRCN0000362176 ACATCAAGGGCTGCAACATAA pLKO_005 809 CDS 100% 13.200 9.240 N Pip5kl1 n/a
6 TRCN0000362097 TCTACCCTACCAGCCGCATTT pLKO_005 776 CDS 100% 10.800 7.560 N Pip5kl1 n/a
7 TRCN0000052540 GTGCTGAAGGACCTCAACTTT pLKO.1 874 CDS 100% 5.625 3.938 N PIP5KL1 n/a
8 TRCN0000025103 CCTACCTTCAATTCTTCAGCA pLKO.1 536 CDS 100% 2.640 1.848 N Pip5kl1 n/a
9 TRCN0000025101 GTATGACATCAAGGGCTGCAA pLKO.1 804 CDS 100% 2.640 1.848 N Pip5kl1 n/a
10 TRCN0000234455 TGCTGAAGGACCTCAACTTTC pLKO_005 875 CDS 100% 10.800 6.480 N PIP5KL1 n/a
11 TRCN0000362235 TGCTGAAGGACCTCAACTTTC pLKO_005 875 CDS 100% 10.800 6.480 N Pip5kl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.