Transcript: Human NM_198220.3

Homo sapiens small nuclear ribonucleoprotein polypeptide B2 (SNRPB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SNRPB2 (6629)
Length:
2311
CDS:
75..752

Additional Resources:

NCBI RefSeq record:
NM_198220.3
NBCI Gene record:
SNRPB2 (6629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221628 GACAGCTACAAGGATTTCCAT pLKO.1 274 CDS 100% 3.000 2.100 N SNRPB2 n/a
2 TRCN0000278413 GACAGCTACAAGGATTTCCAT pLKO_005 274 CDS 100% 3.000 2.100 N SNRPB2 n/a
3 TRCN0000221625 CCATGCTATGAAGATCACCTA pLKO.1 719 CDS 100% 2.640 1.848 N SNRPB2 n/a
4 TRCN0000278447 CCATGCTATGAAGATCACCTA pLKO_005 719 CDS 100% 2.640 1.848 N SNRPB2 n/a
5 TRCN0000221627 GAAGAATTGAAGAGATCCCTA pLKO.1 135 CDS 100% 2.640 1.848 N SNRPB2 n/a
6 TRCN0000278446 GAAGAATTGAAGAGATCCCTA pLKO_005 135 CDS 100% 2.640 1.848 N SNRPB2 n/a
7 TRCN0000221626 GAGACTAATGAGATGATGTTA pLKO.1 555 CDS 100% 5.625 3.375 N SNRPB2 n/a
8 TRCN0000278449 GAGACTAATGAGATGATGTTA pLKO_005 555 CDS 100% 5.625 3.375 N SNRPB2 n/a
9 TRCN0000221624 CCCAAGGAAATTCAACACCAA pLKO.1 475 CDS 100% 2.640 1.584 N SNRPB2 n/a
10 TRCN0000278448 CCCAAGGAAATTCAACACCAA pLKO_005 475 CDS 100% 2.640 1.584 N SNRPB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01569 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01569 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472488 ACGACCGGAAGAGAGCGCAAATTC pLX_317 60.8% 100% 100% V5 n/a
Download CSV