Transcript: Human NM_198236.3

Homo sapiens Rho guanine nucleotide exchange factor 11 (ARHGEF11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARHGEF11 (9826)
Length:
7261
CDS:
1413..6101

Additional Resources:

NCBI RefSeq record:
NM_198236.3
NBCI Gene record:
ARHGEF11 (9826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047466 CGACCGGATCATCAAAGTCAA pLKO.1 1670 CDS 100% 4.950 6.930 N ARHGEF11 n/a
2 TRCN0000331188 CGACCGGATCATCAAAGTCAA pLKO_005 1670 CDS 100% 4.950 6.930 N ARHGEF11 n/a
3 TRCN0000047467 GCGAAACCCTATCCTCAAATA pLKO.1 3128 CDS 100% 13.200 9.240 N ARHGEF11 n/a
4 TRCN0000298935 GCGAAACCCTATCCTCAAATA pLKO_005 3128 CDS 100% 13.200 9.240 N ARHGEF11 n/a
5 TRCN0000047463 CCCTCAGACATGCAAGTGAAA pLKO.1 6433 3UTR 100% 4.950 3.465 N ARHGEF11 n/a
6 TRCN0000298933 CCCTCAGACATGCAAGTGAAA pLKO_005 6433 3UTR 100% 4.950 3.465 N ARHGEF11 n/a
7 TRCN0000047464 CCTGGATCTTACAACCAGAAA pLKO.1 4406 CDS 100% 4.950 3.465 N ARHGEF11 n/a
8 TRCN0000298864 CCTGGATCTTACAACCAGAAA pLKO_005 4406 CDS 100% 4.950 3.465 N ARHGEF11 n/a
9 TRCN0000047465 CCTGATCTTCTACCAGCGAAT pLKO.1 3803 CDS 100% 4.050 2.835 N ARHGEF11 n/a
10 TRCN0000298862 CCTGATCTTCTACCAGCGAAT pLKO_005 3803 CDS 100% 4.050 2.835 N ARHGEF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.