Transcript: Human NM_198243.3

Homo sapiens ankyrin repeat and SOCS box containing 7 (ASB7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ASB7 (140460)
Length:
4926
CDS:
731..1687

Additional Resources:

NCBI RefSeq record:
NM_198243.3
NBCI Gene record:
ASB7 (140460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241514 CAGGACCTGTGCCGAATTAAA pLKO_005 1565 CDS 100% 15.000 21.000 N Asb7 n/a
2 TRCN0000160417 CGGATGTTATATAATTACGGA pLKO.1 1421 CDS 100% 0.750 1.050 N ASB7 n/a
3 TRCN0000161703 GCAATCACTCTTATTGCCGAA pLKO.1 1302 CDS 100% 0.216 0.302 N ASB7 n/a
4 TRCN0000159853 GACAGACTCCTTTACACTTAT pLKO.1 1371 CDS 100% 13.200 9.240 N ASB7 n/a
5 TRCN0000241517 GGTCATGAAAGACTACTTAAA pLKO_005 1645 CDS 100% 13.200 9.240 N Asb7 n/a
6 TRCN0000159488 CGACCATGTTTGGATTTCTTA pLKO.1 1514 CDS 100% 5.625 3.938 N ASB7 n/a
7 TRCN0000160853 GCCAACATCGACATTCAGAAT pLKO.1 1250 CDS 100% 4.950 2.970 N ASB7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04935 pDONR223 100% 85.8% 85.5% None 819_821delACAinsTAT;823_954del n/a
2 ccsbBroad304_04935 pLX_304 0% 85.8% 85.5% V5 819_821delACAinsTAT;823_954del n/a
3 TRCN0000469698 GCCTGTAATGGTGGACCAAATAAA pLX_317 50.7% 85.8% 85.5% V5 819_821delACAinsTAT;823_954del n/a
Download CSV