Transcript: Human NM_198271.4

Homo sapiens leiomodin 3 (LMOD3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
LMOD3 (56203)
Length:
2315
CDS:
210..1892

Additional Resources:

NCBI RefSeq record:
NM_198271.4
NBCI Gene record:
LMOD3 (56203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370894 TCCATCTCTTCTGCGGTAATT pLKO_005 2285 3UTR 100% 13.200 18.480 N LMOD3 n/a
2 TRCN0000365665 TACCATCTGATAAGGGTATTT pLKO_005 2011 3UTR 100% 0.000 0.000 N LMOD3 n/a
3 TRCN0000370830 ATGAGGTGTCTCCAGTTTAAT pLKO_005 1200 CDS 100% 15.000 10.500 N LMOD3 n/a
4 TRCN0000365600 GACAGGAAACTTCAATCATAA pLKO_005 395 CDS 100% 13.200 9.240 N LMOD3 n/a
5 TRCN0000116748 CCCGTGGGAATGATTCAGAAA pLKO.1 354 CDS 100% 4.950 3.465 N LMOD3 n/a
6 TRCN0000116751 GCCCAAGAACAAAGTGAGAAA pLKO.1 822 CDS 100% 4.950 3.465 N LMOD3 n/a
7 TRCN0000376736 CTCAACATCGAGTCCAATTTC pLKO_005 1152 CDS 100% 13.200 7.920 N LMOD3 n/a
8 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 657 CDS 100% 4.950 2.475 Y SET n/a
9 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 657 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03712 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03712 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468697 AGATGGTCTAGCATCGTACTCCAA pLX_317 23.9% 100% 100% V5 n/a
Download CSV