Transcript: Human NM_198321.4

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 10 (GALNT10), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GALNT10 (55568)
Length:
5958
CDS:
135..1946

Additional Resources:

NCBI RefSeq record:
NM_198321.4
NBCI Gene record:
GALNT10 (55568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294134 TGGAACAACATGCAGGTATTC pLKO_005 1623 CDS 100% 10.800 15.120 N GALNT10 n/a
2 TRCN0000294085 ATGAGTACGCAGAGTACATTT pLKO_005 1330 CDS 100% 13.200 9.240 N GALNT10 n/a
3 TRCN0000294086 CCTGTGGGCACTAGGTGTAAA pLKO_005 2023 3UTR 100% 13.200 9.240 N GALNT10 n/a
4 TRCN0000035572 GCAAGAGTTTCAAGTGGTTTA pLKO.1 1429 CDS 100% 10.800 7.560 N GALNT10 n/a
5 TRCN0000286809 GCAAGAGTTTCAAGTGGTTTA pLKO_005 1429 CDS 100% 10.800 7.560 N GALNT10 n/a
6 TRCN0000035569 GCTCCCTTAACTGCAAGAGTT pLKO.1 1417 CDS 100% 4.950 3.465 N GALNT10 n/a
7 TRCN0000035571 GCAGTGAAAGTGACCATAGGA pLKO.1 1831 CDS 100% 3.000 2.100 N GALNT10 n/a
8 TRCN0000286808 GCAGTGAAAGTGACCATAGGA pLKO_005 1831 CDS 100% 3.000 2.100 N GALNT10 n/a
9 TRCN0000035570 GCACACCAAGAAGTTCTGCTT pLKO.1 1685 CDS 100% 2.640 1.848 N GALNT10 n/a
10 TRCN0000035573 CTACAGGAAGTATGTGCCCTA pLKO.1 1247 CDS 100% 2.160 1.512 N GALNT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12225 pDONR223 100% 32.8% 32% None (many diffs) n/a
2 ccsbBroad304_12225 pLX_304 0% 32.8% 32% V5 (many diffs) n/a
3 TRCN0000470329 GCACCGATACCGATCCCCCCAATC pLX_317 61% 32.8% 32% V5 (many diffs) n/a
Download CSV