Transcript: Human NM_198353.3

Homo sapiens potassium channel tetramerization domain containing 8 (KCTD8), mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
KCTD8 (386617)
Length:
2595
CDS:
287..1708

Additional Resources:

NCBI RefSeq record:
NM_198353.3
NBCI Gene record:
KCTD8 (386617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044223 CGGGAAACAAATCTGTCCAAA pLKO.1 1547 CDS 100% 4.950 3.960 N KCTD8 n/a
2 TRCN0000044224 CCTAACACTTTAACATTGGAT pLKO.1 1436 CDS 100% 3.000 2.400 N KCTD8 n/a
3 TRCN0000044227 CTGTTGCAGAAGTATGGGTTA pLKO.1 1685 CDS 100% 4.050 2.835 N KCTD8 n/a
4 TRCN0000044226 CGGCCAGGTTTATGTGACCAA pLKO.1 439 CDS 100% 2.640 1.848 N KCTD8 n/a
5 TRCN0000044225 TCACTGATAAAGGAAGTGAAA pLKO.1 1308 CDS 100% 0.495 0.347 N KCTD8 n/a
6 TRCN0000069671 CAGGTTTATGTGACCAAGCAT pLKO.1 443 CDS 100% 3.000 2.400 N Kctd8 n/a
7 TRCN0000069672 GTCTGTGAGAAGCTAAGTGTA pLKO.1 1574 CDS 100% 4.950 3.465 N Kctd8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15316 pDONR223 96.3% 99.9% 100% None 1269A>G n/a
2 ccsbBroad304_15316 pLX_304 0% 99.9% 100% V5 1269A>G n/a
3 TRCN0000473382 TGCCATTTGCTTCAGTTCCGATTT pLX_317 32% 99.9% 100% V5 1269A>G n/a
Download CSV