Transcript: Human NM_198449.3

Homo sapiens embigin (EMB), mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
EMB (133418)
Length:
4202
CDS:
138..1121

Additional Resources:

NCBI RefSeq record:
NM_198449.3
NBCI Gene record:
EMB (133418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151468 CCTTTGCCATTTGTCTTAGAA pLKO.1 1483 3UTR 100% 5.625 3.375 N EMB n/a
2 TRCN0000154419 GCAACAGGAAGCACCTTGTAT pLKO.1 489 CDS 100% 5.625 3.375 N EMB n/a
3 TRCN0000152301 CACTGACTGAACATTCTAGTA pLKO.1 325 CDS 100% 4.950 2.970 N EMB n/a
4 TRCN0000155775 CCTGTTAAGAGCCTCTGAGTT pLKO.1 1190 3UTR 100% 4.950 2.970 N EMB n/a
5 TRCN0000150700 GCTTTGTTTATCCTTCCTGTT pLKO.1 1175 3UTR 100% 4.050 2.430 N EMB n/a
6 TRCN0000150725 CCTGTTGGTGTTCAAATGAAT pLKO.1 741 CDS 100% 5.625 2.813 Y EMB n/a
7 TRCN0000151423 GCAGTAAATGTGACTTGGAAA pLKO.1 429 CDS 100% 4.950 2.475 Y EMB n/a
8 TRCN0000151147 GAACATTCTAGTATGCCAGTA pLKO.1 333 CDS 100% 4.050 2.025 Y EMB n/a
9 TRCN0000151682 GCTGAAATCAGATGATAGCAA pLKO.1 1046 CDS 100% 3.000 1.500 Y EMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04883 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04883 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470101 GAGCACTGATTAGAACTTCAGTGG pLX_317 49.7% 100% 100% V5 n/a
Download CSV