Transcript: Human NM_198459.4

Homo sapiens DENN domain containing 2C (DENND2C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DENND2C (163259)
Length:
5637
CDS:
272..2887

Additional Resources:

NCBI RefSeq record:
NM_198459.4
NBCI Gene record:
DENND2C (163259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167282 CGTAGGACATTCAGATATTTA pLKO.1 911 CDS 100% 15.000 12.000 N DENND2C n/a
2 TRCN0000167015 GCCTTGTTGTTGTTACATTTA pLKO.1 3204 3UTR 100% 13.200 10.560 N DENND2C n/a
3 TRCN0000425935 GATATTCAGCACTTTCGAAAT pLKO_005 1097 CDS 100% 10.800 8.640 N DENND2C n/a
4 TRCN0000167196 CCATCAGGAATAAGCTATATT pLKO.1 1607 CDS 100% 15.000 10.500 N DENND2C n/a
5 TRCN0000424097 CCGATTGGAACATGTTGATTT pLKO_005 2086 CDS 100% 13.200 9.240 N DENND2C n/a
6 TRCN0000418464 TGGATAGTTCATACGGAATAA pLKO_005 813 CDS 100% 13.200 9.240 N DENND2C n/a
7 TRCN0000167303 CCAATCCTTAAATCAACCTTA pLKO.1 3851 3UTR 100% 4.950 3.465 N DENND2C n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4920 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4920 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13334 pDONR223 100% 81.7% 81.6% None (many diffs) n/a
2 ccsbBroad304_13334 pLX_304 0% 81.7% 81.6% V5 (many diffs) n/a
3 TRCN0000472271 GCTTAGCCCCTCTCTGAAATGCAC pLX_317 15.9% 81.7% 81.6% V5 (many diffs) n/a
Download CSV